A mund ta kundërshtojë Islami evolucionin? – Shqyrtim i ngjashmërive gjenetike mes njeriut dhe shimpanzesë

Daniel Haqiqatjou, Yaqeen Institute for Islamic Research

Evolucionistët ofrojnë një numër të provave shkencore në mbështetje të prejardhjes së përbashkët. Një nga argumentet më të shquara, një argument që ngulitet fort në bisedat laike dhe ndërgjegjen publike në masë të gjerë, është si vijon: Kur shikojmë në të gjithë botën e kafshëve dhe organizmave të tjerë më gjerë, gjejmë se ka “ngjashmëri të habitshme gjenetike” në mes të llojeve me fenotipe të ndryshme (p.sh. karakteristika dukshëm të dallueshme). Për shembull, pavarësisht ndryshimeve të mëdha në tiparet e jashtme të çdo organizmi, gjenomi i shimpanzesë dhe njeriut është rreth 99% identik (ose 98%, 96%, 94% varësisht nga studimi)1. Shkencëtarët e njohur, si Richard Dawkins, shpesh përdorin pohimet e ngjashmërisë gjenetike njeri-shimpanze me argumentet e mëtejshme në lidhje me prejardhjen e përbashkët dhe kundërshtojnë nocionin e veçantisë njerëzore, si dhe narrativin e krishterë dhe islamik të origjinës nga një paraardhës i krijuar, pra Ademit.2

Ajo çfarë nuk i prezantohet publikut të thjeshtë, janë detajet dhe natyra dalluese e kësaj ngjashmërie “të theksuar” gjenetike, që shpesh mbrohet nga intelektualët publik dhe raportimet e ngjashme shkencore.3

Vështruar nga afër, literatura shkencore ofron informata të mëtejme duke vënë pretendimet e ngjashmërisë në një kontekst të duhur. Ajo çfarë është e qartë është se, konkluzioni i ngjashmërisë prej 99%, është një thjeshtëzim mashtrues. Konkluzionet shkencore janë më të matura dhe jo përfundimtare ndaj prejardhjes së përbashkët sesa supozohet shpesh në diskursin publik.

Shkenca e popullarizuar

Kur dikush dëgjon për herë të parë argumentet e ngjashmërisë gjenetike, nuk është edhe aq e vështirë të thellohet edhe më tutje në to. Si mund të argumentoj dikush për 99%-in? Në fakt, sapo të nisësh hulumtimin nëpër literaturë, shpejt e kupton se çështja, megjithatë, nuk është edhe aq e thjeshtë. Për shembull, Chris Moran, profesor i gjenetikës së kafshëve pranë Universitetit të Sidneit, nënvizon se:

Varësisht se çfarë krahasoni, mund të thoni se: ’Po, ka një shkallë shumë të lartë të ngjashmërisë; për shembull, pjesa koduese e proteinave e një njeriu dhe një derri’. Por, në qoftë se krahasoni pjesë jo-koduese që evoluojnë shpejt të një vendi të ngjashëm në gjenom, nuk do të gjeni as edhe një ngjashmëri të vetme të tillë. Kjo do të thotë se, krahasimet përgjithësuese të të gjitha pjesëve të ADN-së të specieve, nuk janë edhe aq domethënëse.4

Për fat të keq, atë çfarë shumëkush nuk po arrin ta kuptojë është se, ajo që gjendet në literaturën shkencore dhe ajo që i kumtohet publikut të rëndomtë, nganjëherë janë dy botë krejtësisht të ndryshme, sidomos kur çështja si ajo e origjinës së njeriut bart ngarkesa ideologjike. Puna komplekse shkencore filtrohet në tinguj të kuptueshëm për konsum masiv. Ky nuk është një problem në vetvete, por, kur ky proces filtrimi formësohet nga një narrativë ideologjike, si “shkenca e pashpirt vs. absurditetit të jashtëzakonshëm të Biblës,” atëherë kjo është pika ku thjeshtëzimet duhet  t’u nënshtrohen rishqyrtimeve.

Duke pasur parasysh këtë, çfarë na thotë literatura shkencore?

Ajo çfarë gjejmë është se krahasimi i dy gjenomeve s’është aspak detyrë  e parëndësishme. Në veçanti, një shqyrtim i hulumtimeve të mëdha mbi këtë temë zbulon se:

  1. Që të gjitha supozojnë prejardhjen e përbashkët si aksiomatike dhe përtej dyshimeve. Me fjalë të tjera, asnjë nga gjenetikët që merret me hulumtimin e ngjashmërisë gjenetike njeri-shimpanze, nuk përpiqet të provojë apo të sjellë argumente sistematike për prejardhjen e përbashkët me anë të verifikimit të përputhshmërisë së nukleotideve mes të dy gjenomeve. Kjo është në kundërshtim me perceptimin popullor se 99% i ngjashmërisë është një argument në vetvete për prejardhje të përbashkët.
  1. Nuk ka ndonjë studim shkencor që ka tentuar të bëjë krahasimin e 100% të gjenomeve të njeriut dhe të shimpanzesë, me qëllim që të përcaktojë përqindjen e përgjithshme të ngjashmërisë. Çdo studim e kufizon krahasimin e vet në nën-seksionet e gjenomit, kurse në disa studime, përfshirë  hulumtimin historik të vitit 1975, për të cilin për herë të parë thuhej se kishte zbuluar ngjashmërinë prej 99%, pjesët e krahasuara përbëjnë më pak se 2% të  totalit të gjenomit.5
  1. Nuk ka as edhe një pajtim të vetëm apo njësi matëse të përdorur gjerësisht me të cilën përcaktohet kuantiteti i ngjashmërisë së dy gjenomeve. Në fakt, çdo dokument në lidhje me temën përdor një metodë dhe parametra të ndryshme në zgjedhjen dhe analizimin e të dhënave përkatëse.
  1. Shumë nga supozimet kryesore të gjenomit njeri-shimpanze, të bëra në revistat e mëdha kërkimore në lidhje me përcaktimin e ngjashmërisë 99%, kanë rezultuar të jenë të gabuara.

Njësitë matëse të krahasueshme

Gjenet e minjve laboratorik kanë  99%6 ngjashmëri të drejtpërdrejtë me njeriun; 80% e gjeneve njerëzore përkojnë me ato të minjve.7 Gjenet njeri- mace përputhen  90%8 dhe gjenet qen-mace përputhen  94%.9 Midis gjeneve të njeriut dhe mizave të frutave gjithashtu ka përputhje, kurse gjenet e njeriut dhe të tharmit përkojnë  31%.10

A është ngjashmëria prej 99% e gjenomit njeri-shimpanze po ashtu më pak mbresëlënëse nën dritën e faktit se gjenet e maceve shtëpiake përkojnë 90% me ato të njerëzve dhe ato të tharmit përkojnë 30% me gjenet tona, etj? Çfarë të bëjmë me këto krahasime të ndryshme kuantitative?

Në të vërtetë, është e vështirë që t’u japim kuptim këtyre përqindjeve pa një njësi matëse të njëtrajtshme. Për fat të keq, shkencat biologjike nuk ofrojnë një të tillë.

Nuk duhet harruar se, që nga 2014, përkimi e gjeneve që lejon këto lloje të krahasimeve ka qenë bërë vetëm për një numër të kufizuar të organizmave (macet, qentë, minjtë, lopët, disa majmunë të mëdhenj, miza të frutave, tharmi, disa baktere, etj); madje edhe atëherë gjenet e shumë pak specieve kanë qenë të renditura krejtësisht.11

Edhe ato që kanë qenë të renditura krejtësisht, vetëm disa prej tyre janë krahasuar direkt me gjenet njerëzore, siç janë ato të majmunëve të mëdhenj. Prandaj biologët evolucionistë nuk mund të ofrojnë ndonjë shtrirje të fuqishme apo të saktë të ngjashmërisë, për shembull, për të gjithë gjitarët, apo të gjitarëve kundrejt zvarranikëve kundrejt peshqve, apo të kurrizorëve kundrejt pakurrizorëve, apo të bimëve kundrejt kafshëve, etj.

Kjo është me rëndësi, sepse çka nëse të gjithë kurrizorët apo të gjithë gjitarët kanë një ngjashmëri gjenetike në një shtrirje prej 80% – 90%? Po ta njihnim këtë shtirje, me të vërtetë do të mund të bënim krahasime të llojit: gjenet njeri- shimpanze përkojnë pjesërisht, të themi, 50% më shumë sesa shkalla mesatare e përkimit mes dy specieve të gjitarëve të tjerë. Krahasimet e këtilla së paku mund të kenë gjasë të jenë prova të nivelit më të ulët.

Logjika këtu është se ne duhet të presim një shkallë të lartë të përkimit të gjeneve ndërmjet organizmave që kanë anatomi të ngjashme. Kjo sepse, në shumicën e kuptimeve fillestare, fenotipi i organizimit është thjesht një pasqyrim i gjenotipit të tij.

Prandaj, ngjashmëritë në mes fenotipeve duhet të kuptohen brenda ngjashmërive në gjenotipe të paktën deri në një farë mase. Për shembull, macet, qentë, shimpanzetë, minjtë, dhe qeniet njerëzore – që të gjitha kanë sistem të ngjashëm të qarkullimit të gjakut, sisteme gastrointestinale, sisteme të frymëmarrjes, sistemet reproduktive, sisteme imunitare, sistem të metabolizmit, si dhe shumë paralele të tjera që radhiten në listë. Duke pasur këtë parasysh, çfarë përqindje të gjenotipeve duhet të presim të përputhen për shkak të të gjitha paraleleve të mëdha fenotipike që shohim mes dy ose më shumë organizmave? Si një krahasim i përgjithshëm, vetëm shikoni sa të ndryshëm janë njerëzit dhe mizat e frutave nga ana e fenotipeve, dhe megjithatë 60% të gjeneve tona përputhen me të tyret!

Nga një analogji e thjeshtë, nuk do të dyshonim po të thuhej se teknologjia e Apple Iphone dhe Samsung Galaxy është 99% e ngjashme. Që të dy njihen si smartphones (telefona të mençur) të madhësisë pothuajse të njëjtë, me funksione të ngjashme: për telefonata, lidhje me internet, aplikacione. Pra do të konsiderohej një përputhje e shkallës së lartë vetëm për shkakun se këto funksione kërkojnë të njëjtin hardware (pjesë mekanike), si: mikroprocesor, module te WiFi-së, kamera, touchscreens, mikrofone, altoparlantë etj. Pohimi se Iphone dhe Galaxy janë rreth 99% të ngjashëm do të ishte i pakuptimtë, veçanërisht nëse del se një Iphone dhe një makinë gatimi janë 60% të ngjashme. Por, po të thuhej se Iphone dhe Galaxy janë 50% më të ngjashëm sesa ngjashmëria mesatare mes dy smartphoneve të tjerë, kjo do të ishte diçka e pazakontë, domethënë ose Apple, ose Samsung janë duke ia vjedhur njëri-tjetrit dizajnin e telefonit.

Thënë ndryshe, kur është në pyetje ngjashmëria njeri-shimpanze, a është ky 99% diçka domethënëse në lidhjen mes shimpanzeve dhe njerëzve, apo ky 99% thjesht ka të bëjë vetëm me të veçantat e skemës krahasuese që studiuesit kanë zgjedhur në përcaktimin e kësaj shifre? Kjo pyetje është veçanërisht e rëndësishme kur kihen pasur parasysh metodat algoritmike të ndërlikuara dhe të dhënat e ndjeshme (f.4) të përdorura në krahasimin e njëmendtë të dy pjesëve (regjioneve, renditjeve) të ADN-së.

Në fund të fundit, gjenetika dhe shkencat biologjike në përgjithësi nuk ofrojnë një kut matës objektiv me të cilin do të mateshin ngjashmëritë e dy gjenomeve dhe, në përgjithësi, nuk ka ndonjë mënyrë të thjeshtë ose standarde për të dhënë një përqindje ngjashmërie mes dy objekteve shumëdimensionale. Për shembull, cila është përqindja e ngjashmërisë mes një molle dhe një portokalli? Atëherë, duke pasur parasysh mënyrat e panumërta të krahasimit të këtyre dyjave, një përgjigje kuptimplote do të duhej t’i krahasonte ngjashmëritë mesatare mes frutave të tjera, për shembull.

Përfundimisht, mungesa e një pikë referimi për t’i normalizuar të dhënat krahasuese e bën supozimin e 99% krejtësisht të pakuptimtë.

Hulumtuesit e shumtë të njohur të cituar në artikullin e revistës “Science” të titulluar “Miti i 1%”, pajtohen rreth këtij vlerësimi të qartë:

Hulumtuesit kanë  gjetur se, në këtë 1%, pjesë të konsiderueshme të ADN- së, gjenet shtesë, lidhjet e ndryshuara në rrjetet e gjeneve, si dhe vetë struktura e kromozomeve e bëjnë befasues çfarëdo krahasimi solid mes “njerëzores” dhe  “shimpanzores”.

Nuk ka as një mënyrë të vetme që paraqet distancën gjenetikore mes dy organizmave të gjallë të ndërlikuar.

“A mund t’i bashkojnë hulumtuesit të gjitha ato çfarë dihen dhe të dalin me një përqindje të saktë të ndryshimeve  mes njerëzve dhe shimpanzeve?” “Nuk mendoj se ka ndonjë mënyrë për të kalkuluar numrat,” thotë gjenetisti Svante Pääbo, anëtar i Konzorciumit të Shimpanzes pranë Institutit Maks Planck për Antropologjinë Evolucionare në Leipzig, Gjermani. “Thënë shkurt, mënyra se si i shohim ndryshimet është një çështje politike, shoqërore e kulturore.”12

Divergjenca e jashtëzakonshme

Kromozomet Y të shimpanzesë dhe të njeriut janë  jashtëzakonisht të ndryshme në përmbajtjen dhe strukturën e gjenit.13

Ky është titulli i një reviste studimore prominente nga viti 2010, që shton një dimension tjetër të krahasimit gjenetik mes njeriut dhe shimpanzesë. Hughes, dhe të tjerët, zbuluan se kromozomi-Y i shimpanzesë ka vetëm 47% të elementeve koduese të proteinave dhe vetëm dy të tretat e gjeneve të dallueshme si ato të kromozomit-Y të njeriut. Po ashtu, më shumë se 30% e të kromozomit-Y të shimpanzesë i mungon çifti te kromozomi-Y i njeriut dhe anasjelltas. Në një pjesë të studimit, autorët madje deklarojnë se:

Ndryshimi në përmbajtjen e gjenit MSY te shimpanzeja dhe të njeriu më shumë krahasohet me ndryshimet e përmbajtjes së gjenit autosomal te pula dhe njeriu.

33

Ajo që me të vërtetë është domethënëse është se Hughes, dhe të tjerët, rikrijuan krahasimin e ADN-së të studimeve të tjera, me qëllim që të krahasojë teknikat e tyre të renditjes.

Ashtu siç edhe pritej, ne kemi gjetur se shkalla e ngjashmërisë mes shimpanzesë orthologous dhe renditjeve MSY së njerëzve (98.3% e identitetit të nukleotideve) ndryshon vetëm pak nga ajo që është raportuar, kur krahasohet me pjesën tjetër të gjeneve të shimpanzesë dhe të njeriut (98.8%).

Kjo do të thotë se “divergjenca e jashtëzakonshme” ekziston pavarësisht ngjashmërisë së renditjes prej 98% në kromozomin-Y, duke lënë të kuptohet se pjesa tjetër e gjenomit po ashtu mund të përmbajë edhe pabarazi të mëdha, edhe pse ngjashmëria e renditjes përcaktohet të jetë 99%, 98%, ose 95%.

Ky nuk është shembulli i parë i dallimeve që gjenetistët kanë zbuluar mes renditjeve gjenetike të majmunit të madh (shimpanzesë) dhe të njeriut.

Kjo fushë ka qenë e njohur për renditjen e gabuar të Y-kromozomeve qysh në vitin 1998.14 Kromozomi 4, 9, 12, dhe në veçanti 21 gjithashtu  janë gjetur të rmbajnëpjesë rastësore të mëdha ndryshimi.”1516 Është interesant fakti se këto mospërputhje zakonisht janë hetuar dhe theksuar në hulumtim duke kërkuar  zbulimin e sekretit gjenetik të “njerëzores”, domethënë ajo që na veçon si njerëz në krahasim me shimpanzenë.

Mospërputhjet janë theksuar edhe në filogjenetikë, d.m.th, analiza gjenetike që përdoret për të përcaktuar mënyrën si organizma të ndryshëm janë të lidhur në trungun evolucionar. Për shembull, në vitin 2007  Ebersberger, et al., pohimi se:

Në 23% të gjenomit tonë ne nuk kemi të përbashkët ndonjë prejardhje gjenetike të atypëratyshme me të afërmin tonë më të afërt të gjallë – shimpanzenë.

Kështu, në dy të tretat e rasteve, rezulton një gjenealogji në të cilën njerëzit dhe shimpanzetë nuk janë të afërmit gjenetik më të ngushtë me njëri-tjetrin. Gjenealogjitë përkatëse nuk përputhen me trugun e specieve. Në përputhje me provat eksperimentale, kjo do të thotë se nuk ka gjë të tillë si historia unike e evolucionit të gjenomit njerëzor. Përkundrazi, ajo i ngjan një arnimi të pjesëve (regjioneve) individuale të gjenealogjive të tyre.17

Dikush mund të pyesë, pse këto studime të thella kromozomale, si ky i Hughes, dhe të tjerëve, nuk përfshijnë të gjitha kromozomet e majmunit? Për shembull, kromozomet e brejtësve dhe mizave të frutave, janë të njohura në hollësi të mëdha, dhe arsyeja është se këto organizma mund të eksperimentohen pafundësisht në hulumtimet mjekësore. Por jo edhe ato të majmunëve. Standardet etike dhe rregullat e ruajtjes së kafshëve nuk lejojnë eksperimentimin invaziv dhe terminal me majmunë. Për këtë arsye, financimi për kërkimin e kromozomeve të majmunëve është relativisht i rrallë, sepse, në fund të fundit, ka disa fusha praktike të kërkesave për çdo zbulim. Pse të humbim miliona dollarë në fonde duke kërkuar kromozome të ngjashme me majmunin, kur më pas, për arsye etike, këto gjetje nuk lejohen të përdoren në avancimin e shkencës mjekësore përmes modifikimit gjenetik dhe eksperimentimit në majmunë të gjallë?

Sidoqoftë, duke pasur parasysh këto mospërputhje të njohura kromozomale dhe filogjenetike nëpër pjesë të shumta të hartës së gjenomit njeri- shimpanze, çfarë duhet të bëjmë me pohimin e ngjashmërisë prej 99% mes njeriut dhe shimpanzesë?

Përgjigja qëndron në detajet e metodologjive që gjenetistët përdorin për të renditur gjenomin njerëzor me atë të shimpanzesë. Për shembull, pasi që njerëzit kanë 46 kromozome në krahasim me 48 sa kanë shimpanzetë, a nuk është ndryshimi 4.2% në shikim të parë? Natyrisht, kjo është thjeshtëzuar qëllimisht. Por çështja është se krahasimi i gjeneve të njeriut me të shimpanzesë nuk është një çështje e thjeshtë e renditjes së këtyre dyjave për të parë sa po përputhen ato, edhe pse pikërisht kjo është përshtypja që mund të paraqesë një jospecialist.

Në fakt, shkenca dhe muzetë e historisë natyrore me ekspozita dedikuar evolucionit – për shembull, projekti i “Explore Evolution që u shfaq në shumë muze të historisë natyrore në gjithë SHBA-në — shpesh  transmetojnë këtë nocion të thjeshtë dhe përfundimisht të pasaktë të ngjashmërisë gjenetike për publikun përmes botimit të disa posterëve me mijëra nukleotide të renditura të përkrah njëri-tjetrit, duke dashur të lënë të kuptohet se ngjashmëria gjenetike mes njeriut dhe shimpanzesë është e qartë si dielli.18 19

44

99%shi i King dhe Wilson

Pra, le të gërmojmë në detajet e renditjes së gjeneve dhe të krahasimit. Hulumtimi fillestar i cili pohonte 99%-shin e ngjashmërisë, është ai i vitit 1975 nga King dhe W ilson, të cilët përdorën tri metoda biokimike për të matur tërthorazi përputhjen gjenetike duke shqyrtuar proteinat e përzgjedhura të njeriut dhe shimpanzesë.20 Një shënim i rëndësishëm është se King dhe Wilson nuk kishin pasur për qëllim të sillnin prova se gjenetika e njeriut dhe shimpanzesë kanë përputhje të madhe. Në fakt, ky ishte një rezultat befasues për ta, dhe ata erdhën në përfundim se:

Rezultati intrigues, i dokumentuar në këtë artikull, është se të gjitha metodat biokimike bien dakord se distanca gjenetike mes njerëzve dhe shimpanzesë, me gjasë, është shumë e vogël për t’u llogaritur dallimet domethënëse të organizmave të tyre.

Sigurisht, ajo që u filtrua për publikun (dhe çfarë u  interpretua më vonë nga shumë njerëz në komunitetin shkencor) ishte se hulumtimi i King dhe Wilson ofroi dëshmi kryesore për prejardhjen e përbashkët.21 Është interesante se vetë King dhe Wilson mendonin se zbulimi i ngjashmërisë gjenetike kundërshtonte dallimin e madh midis dy specieve, aq sa që roli i renditjes gjenetike si përcaktues kryesor i fenotipit të organizmit u vë në pikëpyetje.

Shumë zhurmë për 2%-shin

Përveç kësaj, le të shohim nga afër metodat e hulumtimit të King dhe Wilson. Gjëja e parë që vihet re është se, për shkak të kufijve teknologjik të kohës, metodat e tyre u përqendruan në analizën e proteinave të njeriut dhe të shimpanzesë dhe jo në ato të gjenomit aktual. Madje edhe atëherë ata bënë krahasim vetëm me një pjesë të vogël të proteinave homologe, pasi që ato krahasohen lehtë. Askund nuk pohohet se proteinat e zgjedhura janë përfaqësuese të shumëllojshmërisë së gjerë të proteinave në trupat e njeriut dhe të shimpanzesë. Në fakt, King shprehimisht paralajmëron:

Për shkak  të kufizimeve të metodave konvencionale të renditjes, informacioni i krahasuar saktë nuk është në dispozicion për proteinat më të mëdha. Në të vërtetë, informata e renditjes që është në dispozicion për proteinat e lartpërmendura [në këtë dokument] nuk është ende e plotë.

Përtej këtyre mangësive, ajo që është më e rëndësishme është se më së shumti çka mund të thuhet është se proteinat pasqyrojnë vetëm pjesën koduese të gjenomit, ndërsa pjesët jo-koduese të gjenomit janë shmangur plotësisht. Është interesant fakti se, 98% e gjenomit njerëzor është jo- kodues.26

Cili është dallimi mes pjesëve (regjioneve) koduese dhe jo-koduese të ADN- së? Zakonisht, ADN-ja përmban instruksione gjenetike që përdoren në zhvillimin dhe funksionin e biologjisë së një organizmi. Mekanika e zbatimit të këtyre udhëzimeve është mjaft komplekse dhe nuk dihet plotësisht, por, për ta thjeshtëzuar, pjesa koduese e ADN-së kodon proteina të ndryshëm të cilat shërbejnë si themele të funksionit trupor. Te njerëzit më pak se 2% e të gjithë ADN-së ka të bëjë me këtë proces të kodimit.

Për dekada me radhë, biologët kanë insistuar se pjesët jo-koduese të gjenomit, që përbëjnë mbi 98% të ADN-së sonë, janë thjesht mbeturina.”22

Ata arsyetonin se, meqë këto pjesë jo-koduese nuk luajnë ndonjë rol të theksuar në formimin e proteinave, këto pjesë nuk kishin ndonjë funksion biologjik. Ky supozim, natyrisht, u ka dhënë ngjyrë të gjitha hulumtimeve të mëvonshme lidhur me përputhjen gjenetike njeri-shimpanze.

Për punimin e shquar të King dhe Wilson, fakti se krahasimi i tyre u përqendrua vetëm në elementet koduese të gjenomit do të thotë se ngjashmëria prej 99% që ata gjetën është e pazbatueshme për shumicën dërrmuese – mbi 98% – të materialit të përgjithshëm gjenetik njeri-shimpanze.

Kryetitujt banalë

Edhe në qoftë se konsensusi shkencor pajtohet se zonat jo-koduese të gjenomit nuk luajnë asnjë funksion biologjik, do të ishte një keqinterpretim të thuhej se ADN-ja njeri-shimpanze është 99% e ngjashme në bazë të punimit të King dhe Wilson. Sa i përket shqetësimeve të King dhe Wilson, do të ishte më e saktë të thuhej se, për shembull, “ADN-ja e njeriut dhe e shimpanzesë është 99% e ngjashme … në 2% të gjenomit të krahasuar.” Sigurisht,  që një titull i tillë s’do të tërhiqte edhe aq shumë vëmendje, aq më pak të dukej si një rezultat mahnitës.

Për t’i përkeqësuar gjërat edhe më shumë, pohimi i King dhe Wilson për ngjashmërinë 99%-she është edhe më pak i rëndësishëm pasi të bëhet e qartë se “mbeturina” jo-koduese e ADN-së nuk është edhe aq e pashfrytëzueshme  biologjikisht siç qe supozuar më parë.23 24 Kohëve të fundit, gjenetistët pretendojnë se 80% e ADN-së jo-koduese  është biomekanikisht aktive.25 Edhe më e habitshme është se ata janë duke zbuluar sesi ADN-ja jo-koduese luan një rol thelbësor në rregullimin e proceseve vendimtare gjenetike. Me fjalë të tjera, ajo që deri më 2010 supozohej të ishte “mbeturinë” dhe kryesisht shpërfillej në krahasimet mes gjenetikës njeri- shimpanze, tashmë kuptohet nga biologët të jetë një komponentë e rëndësishme e gjenotipeve tona.

Siç thotë studiuesi Ewan Birney nga European Bioinformatics Institute (Instituti Evropian i Bioinformatikës):

Është mbresëlënëse sa shumë prej gjenomit nuk mbetet pa bërë diçka. Kjo ka ndryshuar perceptimin tim ndaj gjenomit.26

Ki parasysh! 98% e gjenomit tonë është “duke bërë  të paktën diçka” dhe nuk është plotësisht një mbeturinë inerte.

Duke pasur parasysh krahasimin shumë seleksionues dhe të kufizuar të gjenomit njeri-shimpanze që qe bërë nga King, Wilson, dhe të tjerët, nuk është për t’u çuditur që studimet më të fokusuara, që analizojnë deri në detaje kromozome të veçanta, siç është studimi i sipërcituar rreth Y-kromozomeve, gjejnë “dallime të jashtëzakonshme.”

Studime të tjera

Një rishikim i krahasimeve të gjenomit njeri-shimpanze nga studimi i King dhe Wilson tregon se shumë prej tyre i bazojnë konkluzionet e tyre ekskluzivisht në pjesën koduese të gjenomit, i cili përbën vetëm 2% të të gjithë gjenomit (p.sh. Wildman, et al., Nielsen, et al.).27 28 Pjesa tjetër e literaturës – të gjitha datojnë para hulumtimit të 2010 mbi rëndësinë e pjesëve jokoduese – përfshijnë edhe pjesët koduese, edhe ato jokoduese në shkallë të ndryshme (edhe pse pjesët jokoduese në përgjithësi nuk janë theksuar). Megjithatë, këto studime kufizojnë krahasimin e tyre në disa pjesë të totalit të gjenomit, që do të thotë se nuk ka – thua ti se kishte ndonjëherë – krahasim të tërësishëm të renditjeve gjenetike të njeriut dhe shimpanzesë.

Kjo, sigurisht, ndodh në çdo hulumtim që i paraprinë përfundimin e Human Genome Project (HGP) (Projektit të Gjenomit Njerëzor (PGNj)), në vitin 2003 dhe draftit të gjenomit të shimpanzesh nga Konzorciumi mbi Shimpanzetë i vitit 2005.29 Siç  duket askush nuk ka mundur të japë një krahasim të plotë të tërësisë së dy gjenomeve para se ato të kenë qenë renditur pothuajse tërësisht në vitet 2003 dhe 2005. (Madje dhe renditja e gjenomit të shimpanzesë është një draft. Më vonë do të flasim më shumë për këtë.)

Për shembull, Britten në vitin 2002 bëri krahasimin e vetëm 846,016 bazave jashtë totalit të rreth  3.08 miliardave sa e përbëjnë gjenomin e njeriut, që është vetëm 0.03% e totalit.  Arnason, et al., gjashtë vjet më herët, i kishte marrë parasysh vetëm 165,000, që është vetëm 0.006% e totalit. Në vitin 2003 Liu, et al., krahasuan gati 5 milionë, e që është 0.17% e totalit. Në vitin 2002 Ebersberger, et al., krahasuan rreth 3 milionë, që është 0.1% e totalit. Anzai, et al., u përqendruan vetëm në pjesët multi-gjene MHC të gjenomit, që është e lidhur me reagimin imun të kurrizorëve; në total, kjo përbën 0.06% të gjenomit. Në vitin 2003  Thomas, et al., shqyrtuan vetëm 0.06% dhe në vitin 2005  Nielsen, et al., shqyrtuan vetëm 0.6% të totalit.30 31 32 33 34 35 36 37

Studimi i vetëm i cili shqyrtoi shumicën e konsiderueshme të gjenomeve njeri- shimpanze ishte  Konzorciumi i Analizimit dhe Sekuencimit mbi Shimpanzetë i vitit 2005, i cili krahasoi 2.3 miliardë nuklotide, domethënë përafërsisht 76.7% të totalit.38

Në të vërtetë, asnjë nga këto studime nuk pohon 99% ngjashmëri mes gjenomeve njerëzore dhe atyre të shimpanzeve. Përkundrazi, paralajmërimi është gjithmonë aty (diku më qartë, diku jo aq qartë) se 95%, 98%, apo 99% e ngjashmërisë së zbuluar është e kufizuar në segmente të pjesshme të gjenomit të renditur.

Draft renditjet

Tani le të gjurmojmë më thellë renditjet moderne dhe teknikat e krahasimit të gjenomit, në mënyrë që të futemi më thellë në të gjeturat e Konsorciumit mbi Shimpanzenë të vitit 2005, i cili ishte më së shumti i afrohet krahasimit tërësor të renditjes gjenetike njeri-shimpanze.

Para krahasimit të ADN-së, gjenetistët së pari duhet të renditin gjenet në fjalë, gjë në vetvete është një detyrë monumentale. Siç u përmend më lart, vetëm një pjesë e vogël e llojeve të gjenomit është renditur plotësisht. Kjo është për shkak se projektet e renditjes mund të jenë të shtrenjta. Projektit Ndërkombëtar i Gjenomit Njerëzor (PGJNJ), për shembull, iu deshën 3 miliardë dollarë për t’u financuar dhe rreth 13 vite për ta përfunduar hulumtimin. Ndryshe nga PGJNJ, Konozorciumi i Analizimit dhe Renditjes për Shimpanzetë i vitit 2005, nuk ka bërë përpjekje për renditjen e gjenomit të shimpanzesë në mënyrë aq të stërholluar si ai i PGJNj dhe përfundoi duke mbuluar vetëm 94% të tërësisë së genomit.39 Në vend që të kryhej renditja e gjenomit të shimpanzesë deri në fund, hulumtuesit përdorën gjenomin e njeriut si një “skicë” për të mbledhur fragmente të izoluara të renditjes së ADN-s së shimpanzesë. Kjo është bërë me supozimin se njerëzit dhe shimpanzetë kanë lidhje të ngushta, deri në atë masë sa që gjenomi njerëzor mund të përdoret si një referencë për hartimin e ADN-së së fragmentuar të shimpanzesë. Cinikët mes nesh mund të anojnë nga mendimi se fakti që gjenomi njerëzor është shfrytëzuar për ta renditur gjenomin e shimpanzesë do të kishte implikime të rëndësishme në krahasimet e mëvonshëm të këtyre dyjave.

Krahasimi selektiv

Përshtypjen që publiku laik mund ta fitojë nga pohimet e pakualifikuara për ngjashmërinë 99% mes njeriut dhe shimpanzesë është se gjenetistët kanë renditur gjenet dhe kanë krahasuar renditjet e miliarda nukleotideve që përbëjnë strukturën e ADN-së, domethënë A, T, C, G. Për shembull, këtu janë 100 bazat e para të ADN-së mitokondriale të shimpanzesë:

gtttatgtagcttaccccctcaaagcaatacactgaaaatgtttcgacgggtttacatcaccccataa acaaacaggtttggtcctagcctttctattag

Dhe 100 të parat e ADN-së mitokondriale të njeriut:

gatcacaggtctatcaccctattaaccactcacgggagctctccatgcatttggtattttcgtctggg gggtgtgcacgcgatagcattgcgagacgctg

Duke pasur parasysh se i tërë gjenomi njerëzor është në rendin e 3 miliardë nukelotideve dhe gjenomi shimpanzor është afërsisht 10% më i madh, asnjë nocion i krahasimit “të drejtpërdrejtë” nuk mund të merret parasysh. Në fakt, gjenetistët marrin ndihmën e Matematikanëve statistikorë dhe programerëve të kompjuterit për të prodhuar algoritme dhe softuere – p.sh., BLAST është i aftë për të gjetur renditje midis renditjeve masive.40

Para vënies në punë të softuerit BLAST, gjenetistët së pari paraselektojnë pjesët e gjenomit që ata duan  t’i krahasojnë. Ky paraselektim është i nevojshëm për shkak se pjesë të caktuara të gjenomeve njerëzore dhe shimpanzore janë tepër të ndryshme për t’u krahasuar në mënyrë të efektshme duke përdorur algoritme të renditjeve lokale. Pjesët që përsëriten shumë, gjithashtu janë përjashtuar (ose “maskuar”),  sepse BLAST-i dhe programe të tjera do të jepnin rezultate të pasakta, sikur të përfshiheshin këto pjesë. (Në seksionin tjetër do flasim më shumë për këtë.) Në fund të fundit, ngjashmëria përfundimtare e përqindjes së ngjashmërisë nuk përfshin pjesët e përjashtuara. Me fjalë të tjera, krahasimi i gjenomeve është një masë ngjashmërie në renditjet që tashmë janë mjaftueshëm të ngjashme për t’u renditur.

Natyrisht, kjo lloj analize e kufizuar është domethënëse për studiuesit që krahasojnë renditjet gjenetike midis specieve, në mënyrë që të hetojnë gjenet e përbashkëta gjatë avancimeve në shkencën mjekësore. Megjithatë, është e qartë se kjo metodologji në thelb është e kufizuar në mundësinë e saj për të shqyrtuar ngjashmëritë e përgjithshme në tërësinë e dy gjenomeve. Në fund të fundit, pjesët e ndryshimeve përtej një kufiri të caktuar në mënyrë arbitrare janë të përjashtuara pa ngurrim. Përveç shembujve të këtillë, nuk është e qartë se çfarë krahasimi tjetër më të thellë shkencor të gjenomit ka përveç një loje përputhjeje të njëanshme dhe tepër artificiale me qëllim të aprovimit të besimit të rrënjosur thellë në lidhje me ndërlidhjen e njerëzve dhe majmunëve.

Për ta çmuar më mirë këtë deklaratë kundërthënëse në dukje, ajo në të vërtetë na ndihmon për të parë si funksionojnë metodologjitë e renditjes dhe për të dëgjuar mendimet e gjenetistëve të shquar.

Problemi i rendit të renditjes

Personi që nuk i njeh detajet e këtyre krahasimeve mund të pyes veten si janë krahasuar pikërisht dy renditje të nukleotideve si ato të mësipërme. Përgjigja është se nuk ka ndonjë mënyrë për ta bërë këtë. Në fakt, rendi i renditjes është një fushë shumë aktive, meqë studiuesit debatojnë për atë se cilat algoritme të rendit të renditjes japin rezultatet më kualitative e më të besueshme.41 Ashtu siç edhe  Profesori i Shkencave Kompjuterike në Stanford Serafim Batzoglou nënvizon:

Kohët e fundit, literatura mbi metodologjinë dhe zhvillimin e mjeteve ka ardhur duke u rritur, duke treguar kështu se problem i renditjes ende nuk është zgjidhur. Si mund të ndodhë kjo pas gati 40 viteve hulumtim dhe qindra mjeteve në dispozicion?42

Në fakt, Problemi i Rendit të Renditjes është më shumë një problem matematikor sesa biologjik. Për më tepër, ky është një problem i hapur, pasi nuk ekzistonte asnjë zgjidhje përfundimtare.43 Megjithatë, problemi kryesor dihet qartë: Duke pasur parasysh dy (ose më shumë) renditje të shkronjave (p.sh. A, C, T, G) të një gjatësie të caktuar, si mund ta matim si një sasi “distancën” ose “ngjashmërinë” ndërmjet tyre? Për shembull, renditjet në vijim:

TCCCAGTTATGTCAGGGGACACGAGCATGCAGAGAC AATTGCCGCCGTCGTTTTCAGCAGTTATGTCAGATC

Ky është lloji i saktë i të dhënave të analizuara në fushën relativisht të re të bioinformatikës. Pa zbatuar kufizime, ka shumë mënyra të shumta për të renditur lidhur dy renditjet (dy mundësitë e paraqitura më poshtë):

22.png

Hapësirat, e paraqitura me vija, janë një metodë e pranueshme për të renditur renditjet; në kuptimin evolutiv, hapësirat paraqesin ndërshtënie ose fshirje (dmth, “indels”) të nukleotideve në renditjen gjenetike. Teknikisht zëvendësimet e vetme dhe renditjet e anasjella lejohen gjithashtu, gjë që zgjeron edhe më tej hapësirën për renditje të mundshme.

Tani, duke pasur parasysh dy mundësitë e mësipërme, cila renditje është e saktë? Nga numri i madh i renditjeve të mundshme për këtë rend relativisht të shkurtër, si mund të përcaktojmë cila renditje paraqet saktë lidhjen filogjenetike mes dy specieve? Mbi të gjitha, ne nuk kemi qasje në ADN-në e paraardhësit hipotetik të përbashkët për të krahasuar, për të dalluar, dhe për të vlerësuar secilën mundësi. Sidoqoftë, sapo të vendosim cila renditje është e saktë, ne mund ta listojmë përqindjen e ngjashmërisë duke numëruar përputhjet.

Rëndësia e gjithë kësaj është se ngjashmëria e përgjithshme e përqindjes së dy rendeve përfundimisht varet nga skema e renditjes së përzgjedhur. Për më tepër, mungesa e një skeme të standardizuar të renditjes i paraqet si problematike dhe i vë në dyshim rezultatet e studimeve krahasuese nëpër gjenome të ndryshme.

Krahasimet në shkallë të madhe mes gjenomit zakonisht preferojnë “renditjen lokale” në krahasim me “renditjen globale.” Në shembullin e mësipërm, renditja në majë paraqet një renditje globale, ndërsa ajo në fund paraqet një renditje lokale. Në studimet krahasuese të gjenomeve, si ajo e Konsorciumit mbi Shimpanzenë të vitit 2005, renditja lokale preferohet me supozimin se, duke pasur parasysh shtrirjet e gjata të ADN-së, vetëm disa pjesë janë të lidhura në një det renditjesh jointeresante të nukleotideve. Për shembull, në renditjen lokale më lart, kjo konsiderohet 100% ngjashmëri. Zonat e parenditura thjesht nuk përfillen. Kështu funksionon renditja me anë të BLAST: programi merr një renditje-mostër të një gjatësie të caktuar dhe skanon bazën e të dhënave të gjenomit, derisa t’i paraqet të gjitha përputhjet e mundshme, disa prej tyre me një shkallë më të madhe e disa më të vogël të ngjashmërisë për shkak të fshirjeve (të nukleotideve), zëvendësimeve, etj. Vendndodhja relative e përputhjeve brenda kontekstit të të gjithë gjenomit nuk faktorizohet, sepse përsëri supozohet se renditjet e përputhura janë të rrethuara nga rajone të parëndësishme rendi i të cilave nuk ka rëndësi. Siç biokimisti amerikan  Russell Doolittle:

Mesazhi i nënkuptuar është se duhet qenë i vëmendshëm ndaj pjesëve (regjioneve) të ngjashmërisë, edhe kur ato janë të futura në një sfond të përgjithshëm të pangjashmërisë.44

Pangjashmëria e sfondit, natyrisht, përjashtohet nga llogaritja e përgjithshme e përqindjes së ngjashmërisë. Në të vërtetë, kur është fjala për gjenomin njerëzor, edhe studimet modeste duhet të marrin në konsideratë shumë kilobaza të të dhënave të renditjes. Gjenetistët e reduktojnë kompleksitetin e problemit të renditjes duke kufizuar krahasimin e renditjes së tyre në pjesët që janë më të përshtatshme për renditje, të cilat rastësisht kanë ndodhur të jenë pjesët (regjionet) me interesin më të madh gjenetik (të paktën para se të zbulohej rëndësia e pjesëve jokoduese me përsëritje të lartë, e elementeve që ndryshojnë pozitën në gjenom, etj. në vitin 2010). Ka  programe të veçanta kompjuterike si p.sh. DUST që “maskon” këto regjione sfondi të papërshtatshme dhe “jo interesante” të gjenomit.45 Siç u përmend më lart, regjionet e maskuara nuk janë të përfshira në kalkulimin e përqindjes së ngjashmërisë së përgjithshme. Por, sa i rëndësishëm është ky përjashtim?

“Materia e errët” e Gjenomit

Për të kuptuar  shkallën e “kompleksitetit të ulët” të regjioneve të përsëritura, ne mund të fillojmë duke cituar tërësisht një pasazh nga një studim i vitit 2011 i bërë nga  Koning, et al.:

Gjenomet eukariotike përmbajnë miliona kopje të elementeve që ndryshojnë pozitat e tyre në gjenom (TE) dhe renditje të përsëritura. Në të vërtetë, afërsisht gjysma e përmbajtjes së renditjes të gjenomeve tipike të gjitarëve tenton të shënohet si TE dhe si përsëritje të thjeshta nga metodat konvencionale të anotimit. Në kontrast me këtë, vetëm nja 5-10% e renditjeve të gjenomit të gjitarëve dhe të kurrizorëve përbëhen nga gjenet dhe nga elemente të njohura funksionale. Pjesa e mbetur prej 40-45% të gjenomit ka një funksion të panjohur dhe nganjëherë kësaj i referohet si “materia e errët” e gjenomit njerëzor. Origjina e kësaj pjese të “materies së errët” të gjenomit supozohet se është hijezuar pjesërisht nga rirenditja e shumtë dhe dallimet në renditje përgjatë kohëzgjatjes së thellë evolutive. Të kuptuarit e përmbajtjes dhe të origjinës së këtij komponenti të stërmadh të pacilësueshëm të gjenomit paraqet një hap të rëndësishëm drejt deshifrimit të plotë të organizimit dhe funksionit të renditjes njerëzore të gjenomit.46

Elementet transpozuese (TE) janë renditje të ADN-së që mund të ndryshojnë pozitën në evoluimin e gjenomit. Para studimeve si ajo e Koning, et al. (2011) dhe Bucher, et al., (2012), të cilat kanë vërtetuar rëndësinë e këtyre elementeve të ndryshueshme, TE-të shiheshin si “parazitë  të gjenomit  bartës” funksioni i vetëm i dallueshëm i të cilëve ishte të errësonte regjionet e gjenomit të cilat gjenetistët ishin më së shumti të interesuar t’i hulumtonin.47

Siç e kemi parë, këto regjione kanë qenë të maskuara në studimet historike të renditjes së gjenomit, por, siç sugjeruan Koning, et al., këto regjione përbëjnë mbi 66% të gjenomit. Vlerësimet e tjera shtrihen nga  40% deri në  50%.48 49

Kjo do të thotë se studimet si ai i Konsorciumit mbi Shimpanzetë i vitit 2005, që maskuan regjionet e përsëritura dhe shpërfillën regjionet transpozuese (TE) që rrethojnë rendet e renditura, kanë përjashtuar deri në 40% të të gjithë gjenomit në analizat e tyre. Në vitin 2005 dhe deri në fund të vitit 2010, këto përjashtime do të mund të arsyetoheshin bazuar në atë se këto regjione nuk kishin rëndësi funksionale për organizmin dhe për aspektet filogjenetike në përgjithësi. Por, siç e kemi parë, hulumtimet e kaluara brenda 4 viteve të fundit tregojnë se supozimet e tilla ishin gabime të rënda.

Konkluzion

Shumë më tepër mund të thuhet në lidhje me detajet shkencore të renditjes së gjenomit dhe krahasimit gjenomik. Fushat e bioinformatikës dhe të gjenetikës evolutive kanë qenë në një gjendje të zhvillimit të shpejtë gjatë dekadës së kaluar dhe nuk po tregojnë shenja të ngadalësimit. Siç njoftojnë mediat e njohura lidhur me këto zhvillime, po bëhet gjithnjë e më e rëndësishme për komentuesit që të përfshijnë paralajmërime dhe kontekste, kur ua shpjegojnë gjetjet shkencore publikut (që s’i dinë detajet shkencore). Ky kujdes do të sigurojë që të dhënat shkencore nuk janë shpërdoruar shkel e shko gjatë mbështetjes së konkluzioneve ideologjike.

Përtej rreziqeve të raportimit të pamenduar, një temë që na përsëritet gjatë rishikimit të literaturës krahasuese rreth gjenomit është se vetë shkenca është larg nga të qenët bindëse. Për shembull, supozimet e shumta të mëdha të bëra në vitin 2005 nga ana e studimit Konsorciumit mbi Shimpanzetë, të tilla si rëndësia e jokodimit, regjionet e përsëritura dhe regjionet që ndryshojnë pozitën në gjenom (TE), u zhvlerësuan me vrazhdësi deri në vitin 2010. Megjithatë, vetëm nëpërmjet një vlerësimi të këtillë selektiv të gjenomit, të udhëhequr nga këto supozime të gabuara, u nxor përqindja e ngjashmërisë prej 95%.

Çfarë do të thotë e gjithë kjo për prejardhjen e përbashkët? Ajo që është e dukshme për shumë specialistë, siç u citua më sipër, është se përpjekja për të matur në kuptimin sasior ngjashmërinë e gjenomit është një ndërmarrje e pakuptimtë dhe e marrë. Shpresojmë se ky ese të ketë ofruar substancën e duhur për këtë përfundim. Në fund, deklarimi i ngjashmërinë prej 99% në vetvete zor se argumenton në favor të prejardhjes së përbashkët, përveç si një forcë për t’i hutuar ata që s’i njohin detajet e këtij konteksti. Kjo nuk do të thotë se biologët nuk kanë dëshmi tjera të kuptueshme për prejardhjen e përbashkët. Vetë Darwini, natyrisht, besoi se kishte zbuluar dëshmi të shumta për prejardhjen e përbashkët dhe këtë pa ndihmën e analizës gjenetike. Asnjë prej këtyre dëshmive të tjera, ndërkaq, nuk kanë luajtur një rol të madh në vetëdijen publike dhe në pranimin e gjerë të idesë darviniane të prejardhjes së përbashkët sesa pohimi i ngjashmërisë prej 99%. Por, siç e pamë, kjo thjesht nuk qëndron.

Përkthyen: Arton Hasani dhe Visar Zeka


Fundnota:

1 . King, M., and A. Wilson. “Evolution At Two Levels In Humans And Chimpanzees.” Science 188.4184 (1975): 107-116.

Wildman, D. E. “Implications Of Natural Selection In Shaping 99.4%  Nonsynonymous DNA Identity Between Humans And Chimpanzees: Enlarging Genus Homo.” Proceedings of the National Academy of Sciences 100.12 (2003): 7181-7188.

NIH/National Human Genome Research Institute. “Comparing the chimp and human genomes.” N.p., 31 Aug. 2005. Web. 5 Apr. 2014. http://genome.wellcome.ac.uk/doc_WTD020730.html.

Demuth, Jeffery P., et al. “The Evolution of Mammalian Gene Families.” PLoS ONE 1.1 (2006): e85.

2 “Richard Dawkins– Comparing the Human and Chimpanzee Genomes.” YouTube. 16 Mar. 2012. Web. 5 Apr. 2014.  https://www.youtube.com/watch?v=agraHxYui_4.

3 Broad Institute of MIT and Harvard. “Comparison of human and chimpanzee genomes reveals striking similarities and differences.” Broad Institute of MIT and Harvard. Broad Institute Communications, 31 Aug. 2005. Web. 5 Apr. 2014. http://www.broadinstitute.org/news/263.

4 ABC Science. “Do pigs share 98 per cent  of human genes?” ABC Science, 3 May 2010. Web. 5 Ap 2014. http://www.abc.net.au/science/articles/2010/05/03/2887206.htm.

5 King, M., and A. Wilson.

6 Gunter, Chris, and Ritu Dhand. “Human Biology By Proxy.” Nature 420.6915 (2002): 509-509.

7 Church, Deanna M., et al. “Lineage-Specific Biology Revealed by a Finished Genome Assembly of the Mouse.” PLoS Biology7.5 (2009): e1000112.

8 Pontius, J. U., et al. “Initial Sequence And Comparative Analysis Of The Cat Genome.” Genome Research 17.11 (2007): 1675-1689.

9 National Human Genome Research Institute. “Comparative Genomics Fact Sheet.” N.p., 13 Nov. 2011. Web. 3 Apr. 2014.  https://www.genome.gov/11509542.

10 Botstein, D. “Genetics: Yeast as a Model Organism.” Science 277.5330 (1997): 1259-1260.

11 “List of sequenced animal genomes.” Wikipedia. Wikimedia Foundation, 30 Mar. 2014. Web. 5 Ap 2014. http://en.wikipedia.org/wiki/List_of_sequenced_animal_genomes. 

List of sequenced eukaryotic genomes.” Wikipedia. Wikimedia Foundation, 4 Feb. 2014. Web. 5 Ap 2014. http://en.wikipedia.org/wiki/List_of_sequenced_eukaryotic_genomes.

14 Archidiacono, Nicoletta, et al. “Evolution of chromosome Y in primates.” Chromosoma 107.4 (1998): 241-246.

15 Gibbons, Ann. “Which of Our Genes Make Us Human?” Science, 4 Sept. 1998. Web. 6 Apr. 2014.  http://www.sciencemag.org/content/281/5382/1432.

16 Fujiyama, A., et al. “Construction and Analysis of a Human-Chimpanzee Comparative Clone Map.” Science 295.5552 (2002): 131-134.

17 Ebersberger, I., et al. “Mapping Human Genetic Ancestry.” Molecular Biology and Evolution 24.10 (2007): 2266-2276.

18 Explore Evolution. “Explore Evolution :: Project Overview.” University of Nebraska State Museum, n.d. Web. 6 Apr. 2014.  http://explore-evolution.unl.edu/overview.html.

19 “Richard Dawkins– Comparing the Human and Chimpanzee Genomes.” YouTube.

20 King, M., and A. Wilson.

21 Morange, Michel. “The genetic distance between humans and chimpanzees: What did Mary-Claire king and Allan Wilson really say in 1975?.” Journal of Biosciences 36.1 (2011): 23-26.

22 Ohno, S. “So much  “junk” DNA in our genome.” Brookhaven Symposia in Biology. 23:366-70 (1972).

23 Polavarapu, Nalini, et al. “Characterization and potential functional significance of human-chimpanzee large INDEL variation.” Mobile DNA 2.1 (2011): 13.

24 Nowacki, M., et al. “A Functional Role for Transposases in a Large Eukaryotic Genome.” Science 324.5929 (2009): 935-938.

25 Park, Alice. “Junk DNA.” Time. 12 Sept. 2012. Web. 6 Apr. 2014. http://healthland.time.com/2012/09/06/junk-dna-not-so-useless-after-all/.

26 Park, Alice.

27 Wildman, D. E.

28 Nielsen, Rasmus, et al. “A Scan for Positively Selected Genes in the Genomes of Humans and Chimpanzees.” PLoS Biology 3.6 (2005): e170.

29 The Chimpanzee Sequencing and Analysis Consortium. “Initial Sequence Of The Chimpanzee Genome And Comparison With The Human  Genome.” Nature 437.7055 (2005): 69-87.

30 Britten, R. J. “Divergence between samples of chimpanzee and human DNA sequences is 5%, counting indels.” Proceedings of the National Academy of Sciences 99.21 (2002): 13633-13635.

31 International Human Genome Sequencing Consortium. “Finishing The Euchromatic Sequence Of The Human Genome.” Nature 431.7011 (2004): 931-945.

32 Arnason, Ulfur, et al. “A complete mitochondrial DNA molecule of the white-handed gibbon, Hylobates lar, and comparison among individual mitochondrial genes of all hominoid genera.” Hereditas 124.2 (1996): 185-189.

33 Liu, G., et al. “Analysis of Primate Genomic Variation Reveals a Repeat-Driven Expansion of the Human Genome.” Genome Research 13.3 (2003): 358-368.

34 Ebersberger, I., et al. “Mapping Human Genetic Ancestry.” Molecular Biology and Evolution 24.10 (2007): 2266-2276.

35 Anzai, T., et al. “Comparative sequencing of human and chimpanzee MHC class I regions unveils insertions/deletions as the major path to genomic divergence.” Proceedings of the National Academy of Sciences 100.13 (2003): 7708-7713.

36 Thomas, J. W., et al. “Comparative analyses of multi-species sequences from targeted genomic regions.” Nature 424.6950 (2003): 788-793.

37 Nielsen, Rasmus, et al.

38 The Chimpanzee Sequencing and Analysis Consortium.

41 Polyanovsky, Valery O, et al. “Comparative analysis of the quality of a global algorithm and a local algorithm for alignment of two sequences.” Algorithms for Molecular Biology 6.1 (2011): 25.

42 Batzoglou, S. “The many faces of sequence alignment.” Briefings in Bioinformatics 6.1 (2005): 6-22.

43 Carrillo, Humberto, and David Lipman. “The Multiple Sequence Alignment Problem in Biology.” SIAM Journal on Applied Mathematics 48.5 (1988): 1073.

44 Doolittle, Russell F. “Searching through Sequence Databases.” Molecular evolution: computer analysis of protein and nucleic acid sequences. San Diego: Academic Press, 1990. 99-110

45 Morgulis, A., et al. “WindowMasker: window-based masker for sequenced genomes.” Bioinformatics 22.2 (2006): 134-141.

46 Koning, A. P. Jason De, et al. “Repetitive Elements May Comprise Over Two-Thirds of the Human Genome.” PLoS Genetics 7.12 (2011): e1002384.

47 Bucher, Etienne, et al. “Epigenetic control of transposon transcription and mobility in Arabidopsis.” Current Opinion in Plant Biology 15.5 (2012): 503-510.

48 Varki, Ajit, and David L. Nelson. “Genomic Comparisons of Humans and Chimpanzees.” Annual Review of Anthropology 36.1 (2007): 191-209.

49 Shapiro, James A., and Richard Von Sternberg

Advertisements